Metabolic engineering by promotor fine tuning

Red/ET recombination has been used for a promotor fine tuning in E. coli by replacing an entire promotor region or 5´elements with a synthetic promotor library (SPL).  SPL is based on randomized sequences flanking the consensus -10 and -35 promotor regions and allows fine-tuning of bacterial gene expression, overcoming the common all-or-nothing approach: change of gene expression by deletion and/or strong overexpression.

More precisely, the native promotor of the genomic localized phosphoglucose isomerase (pgi)-lacZ reporter construct was replaced by an SPL, and promotor sequences that resulted in activity range of 25%to 570%of the native pgi-promotor were rapidly identified in a blue white screening and a following beta-galactosidase activity test by Miller.

The combination of recombineering and SPL is applicable for optimizing gene expression in cell factories to remove bottlenecks or to reduce activities of metabolic pathways producing unwanted by-products.

SPL: N(5)TTGACAN(17)TATAATN(5)AAATCAGAAGAGTATTGCTAATG