HSP90AB1 (NM_007355) Human 3' UTR Clone

Référence SC204035

Conditionnement : 10µg

Demander plus d'informations

Contactez votre distributeur local :


Téléphone :

HSP90AB1 (NM_007355) Human 3' UTR Clone

SKU
SC204035
3' UTR clone of heat shock protein 90kDa alpha (cytosolic) class B member 1 (HSP90AB1) for miRNA target validation
In Stock*
Bulk Requests & Clone Modifications
Specifications
Product Data
Vector pMirTarget
Species Human
transfection_reporter RFP
assay_reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol HSP90AB1
Synonyms D6S182; HSP84; HSP90B; HSPC2; HSPCB
ACCN NM_007355
Insert Size 315 bp
Sequence Data
Insert Sequence
>SC204035 3’UTR clone of NM_007355
The sequence shown below is from the reference sequence of NM_007355. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGCGTCTCGCATGGAAGAAGTCGATTAGGTTAGGAGTTCATAGTTGGAAAACTTGTGCCCTTGTATA
GTGTCCCCATGGGCTCCCACTGCAGCCTCGAGTGCCCCTGTCCCACCTGGCTCCCCCTGCTGGTGTCTA
GTGTTTTTTTCCCTCTCCTGTCCTTGTGTTGAAGGCAGTAAACTAAGGGTGTCAAGCCCCATTCCCTCT
CTACTCTTGACAGCAGGATTGGATGTTGTGTATTGTGGTTTATTTTATTTTCTTCATTTTGTTCTGAAA
TTAAAGTATGCAAAATAAAGAATATGCCGTTTTTATACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_007355.4
Locus ID 3326
Summary This gene encodes a member of the heat shock protein 90 family; these proteins are involved in signal transduction, protein folding and degradation and morphological evolution. This gene encodes the constitutive form of the cytosolic 90 kDa heat-shock protein and is thought to play a role in gastric apoptosis and inflammation. Alternative splicing results in multiple transcript variants. Pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Dec 2012]

Vous serez peut-être également intéressé par les produits suivants :



Référence
Description
Cond.
Prix HT